🚀 go-pugleaf

All,

Please find below the August newsletter.

cheers Ed
-- 
 ------------------------------------------------------------------------
| Ed Griffiths, Acedb development, Informatics Group,                    |
|        Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus,  |
|               Hinxton, Cambridge CB10 1SA, UK                          |
|                                                                        |
| email: edgrif@sanger.ac.uk  Tel: +44-1223-494780  Fax: +44-1223-494919 |
 ------------------------------------------------------------------------


------------------------------------------------------------------------
------------------------------------------------------------------------


  ACEDB User Group Newsletter - August 2004
  #########################################

If you want to have this newsletter mailed to you *_or_* you want to
make comments/suggestions about the format/content then send an email to
acedb@sanger.ac.uk <mailto:acedb@sanger.ac.uk>.

------------------------------------------------------------------------

This month sees a PHP interface to AceDB, more support for compiling
AceDB on the Opteron, some new additions to the command line interface,
changes to embl dumping of accession numbers, extension to GFF "type"
dumping, an AQL bug fixed and some developer bits.

------------------------------------------------------------------------


    New Features
    ************


      A PHP interface to AceDB
      ++++++++++++++++++++++++

(/This article is courtesy of Hamish McWilliam/
software@hpm101.gotadsl.co.uk <mailto:software@hpm101.gotadsl.co.uk>)

Hamish McWilliam has been working on a PHP interface to AceDB, here's
what he has to say about it:

*_AcePHP: a PHP interface to AceDB_*

While AcePerl is wonderful for scripts and web applications, it is
problematic when a small amount of dynamic content is required in an
otherwise static page. PHP is an ideal solution for this circumstance
and since it supports sockets it is possible to use the AceDB socket
server to access data in an AceDB database, and embed it in the page. To
faciliate this a PHP library has been developed that allows access to
most of the capabilites of AceDB. This library is pure PHP so no
re-compilation of the web server is required. For simple object counts
in a database description or one off queries in otherwise static web
pages I can think of no simpler method.

It's now works well for simple things like object counts for a query,
number of objects in a class or small queries, there are still some
problems handling large objects.

If you want to have a play with it, you can find details, crude demos
and downloads at:

http://hpm101.gotadsl.co.uk/projects/acephp/

Hamish.


      Opteron port
      ++++++++++++

(/This article is courtesy of Jean Thierry-Meig/ mieg@ncbi.nlm.nih.gov
<mailto:mieg@ncbi.nlm.nih.gov>)

Jean has added a new defs file to the wmake directory,
*OPTERON_4_DEF*, for compiling AceDB on the Opteron which should help
to ease the problems that some people have experienced in referencing
the correct libraries for building AceDB on this 64-bit Linux platform.

Please note that while the all the binaries from the AceDB source
package have been compiled and run on the Opteron, other extensions to
AceDB, e.g. AcePerl, are yet to be ported.


      Some New SMap commands
      ++++++++++++++++++++++

For some time now there has been an smap command in giface that enables
you to find out the coordinates of a feature in a parent:

|acedb-gif> smap -from cds:b0250.4 -to sequence:b0250
SMAP Sequence:B0250 7671 1839 1 1443 INTERNAL_GAPS
// 1 Active Objects
acedb-gif>
|

(N.B. "|INTERNAL_GAPS|" is returned because cds:b0250.4 consists of
exons and introns and hence its mapping to sequence:b0250 is not
contiguous.)

The command defaults to finding a feature in that features ultimate
parent in the database:

|acedb-gif> smap -from sequence:b0250
SMAP Sequence:CHROMOSOME_V 20454867 20494082 1 39216 PERFECT_MAP
acedb-gif>
|

This command is now available in tace and giface (and the corresponding
servers), it has been added to the base command menu so there is no need
to go into the gif submenu. (Note the smap command has been left in the
gif submenu for compatibility with scripts/aceperl programs that rely on
this.)

There are now two additional commands in the base command menu that
access SMap functions:

    * *|smapdump:|* dumps a text version of the complete SMap for an
      object to the terminal.
    * *|smaplength:|* gives the length of an object (this is not always
      obvious as the objects length may be given by the maximum extent
      of the coordinates of its S_Child features or may be specified
      explicitly in its S_Parent object).

Output from smaplength is simply the length of the object:

|acedb> smaplength sequence:b0250
SMAPLENGTH Sequence:"B0250" 39216
// 1 Active Objects
acedb>
|

Output from smapdump may be voluminous:

|acedb> smapdump cds:B0250.4
SMAPDUMP CDS:"B0250.4"

sMap->nnnn:
        sMap->length = 1443
        sMap->area1 = 1, sMap->area2 = 1443

sMap->root->nnnn:
        Root = Sequence:"CHROMOSOME_V" [20462537,20456705]
        sMapLength = 1443

*** CDS:"B0250.4", orient = Down, map = 1,1443->1,1443
   *** Sequence:"B0250", orient = Up, map = 1839,1902->1443,1380
2361,2525->1379,1215 3247,3351->1214,1110 3400,3540->1109,969 4131,4301->968,798
4416,4517->797,696 4925,5004->695,616 5055,5160->615,510 5866,6015->509,360
6087,6188->359,258 6281,6421->257,117 7511,7557->116,70 7603,7671->69,1
      *** Gene:"WBGene00007121", orient = Down, map = 1,69->1,69 115,161->70,116
1251,1391->117,257 1484,1585->258,359 1657,1806->360,509 2512,2617->510,615
2668,2747->616,695 3155,3256->696,797 3371,3541->798,968 4132,4272->969,1109
4321,4425->1110,1214 5147,5311->1215,1379 5770,5833->1380,1443
      *** CDS:"B0250.gc1", orient = Down, map = 1,1443->1,1443
      *** Transcript:"B0250.4", orient = Down, map = 1,1443->1,1443

      *< lots more features not shown >*

            *** Homol_data:"CHROMOSOME_V:waba", orient = Up, map =
20456705,20456768->1443,1380 20457227,20457391->1379,1215
20458113,20458217->1214,1110 20458266,20458406->1109,969
20458997,20459167->968,798 20459282,20459383->797,696 20459791,20459870->695,616
20459921,20460026->615,510 20460732,20460881->509,360 20460953,20461054->359,258
20461147,20461287->257,117 20462377,20462423->116,70 20462469,20462537->69,1

sMap dna:
Length = 1443 (only first 1,000 bases printed)
    1 atgacgtcgtttacaataaacaaacagcaactggaagaaatgatccggca
   51 gcttcaggatcggctcgaaagtggagcattcaataaacaaactggaaata

   *< lots more bases not shown >*

  901 ggcaaacgatcgtggtatggggtgatggaagtatctaaacaacgtaggga
  951 gcattacatttccgaagaagatttttacactaaattcccaggagcatgta

// 1 Active Objects
acedb>
|

You can see descriptions of smap* command usage online:

|acedb> ? smap*
// Keyword smap* does not match
// ACEDB list of commands matching smap**:
smap [-coords x1 x2] -from class:object [-to class:object] :
             maps cordinates between sequences that have a child -> parent
relationship expressed in SMap tags (or the now deprecated Source/Subsequence
tags).
             Note that objects must be specified in "class:object" as smap can
map any class that contains SMap tags.
        -coords x1 x2      coords to be mapped in the -from object, defaults to
whole of -from object.
        -from class:object object to be mapped into one of its parent.
        -to class:object   object to be mapped to, must be a parent of the -from
object, defaults to top parent in the smap tree above -from object.
smapdump class:object : dumps to stdout the smap for the object.
smaplength class:object : gives the length of the object.
// 1 Active Objects
acedb>|


      New quiet command
      +++++++++++++++++

AceDB terminal output usually includes comments at the end even if the
command worked:

|acedb> gif seqget 1.12985533-13293939 ; seqfeatures -file myfile
##gff-version 2
##source-version giface:ACEDB 4.9.27
##date 2004-09-01
##sequence-region 1.12985533-13293939 1 308407
1.12985533-13293939     .       Sequence        1       88806   .       +
.       Sequence "AL603890.14.1.88806"
1.12985533-13293939     .       Sequence        1       308407  .       +
.       Sequence "1.12985533-13293939"

          (many more lines)

1.12985533-13293939     .       Clone_right_end 189119  189119  .       .
.       Clone "RP11-133N1"
1.12985533-13293939     .       Clone_left_end  189120  189120  .       .
.       Clone "RP4-597A16"
1.12985533-13293939     .       Clone_right_end 308407  308407  .       .
.       Clone "RP4-597A16"
// FMAP_FEATURES "1.12985533-13293939" 1 308407
// 15 Active Objects
acedb>
|

For interactive use of tace, giface, the servers, this is very important
as it gives the user feedback about the command and the active keyset.
This may not be so good for programs that must parse the output as they
must all be coded to process the comment lines.

The new "quiet" command (which is available from the base or gif command
menus) suppresses AceDB comments when the command works but passes the
comment through if the command fails. This allows a program to easily
parse the output and detect whether the command succeeded or failed.
With quiet mode on in the above example either valid GFF lines would be
returned or a comment because there was an error.

The command description is:

|acedb> ? quiet
// ACEDB command: quiet
quiet -on | -off :
        Turn quiet mode on or off, when "on" commands produce only their output
without any extra comments.
        (Note the usual "NNN Active Objects" is no longer displayed, use the
Count command.)
        Quiet mode makes parsing command output easier because either the first
line
        is an acedb comment because the command failed or there are no acedb
comments in the output.
        -off    (default) verbose output
        -on     no comments unless there is an error.

// 0 Active Objects
acedb>
|

(Note that if you turn quiet mode on in the base menu then it will also
be on in the gif menu.)

Full support of this option for all commands will take time to implement
so if you find a command which does not produce "quiet" output as you
would expect please email acedb@sanger.ac.uk <mailto:acedb@sanger.ac.uk>
with examples.

------------------------------------------------------------------------


    Articles
    ********


      Change to how EMBL dumping in AceDB dumps accession numbers
      +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++

There has been a change to the way AceDB embl dumping works for
accession numbers, the changes have been made to support new tags in
wormbase.

The original tags that the embl dump code read the accession number from
were:

        Database ?Database ?Text ?Accession_number

This worked while accession data was stored in this form:

    ?Sequence C04G2
    Database EMBL CEC04G2 Z70718

The accession number dumped for the above was: "z70718".

The new tags in worm are:

        Database ?Database ?Database_field ?Accession_number

        (n.b. change of ?Text to ?Database_field, but essentially the same)

In particular the accession number is now specified by the object
following a ?Database_field object with the name "NDB_AC":

  ?Sequence C04G2
    Database EMBL    NDB_ID    CEC04G2
             EMBL    NDB_AC    Z70718
             EMBL    NDB_SV    Z70718.1

The old code would return "CEC04G2" as the accession number which is not
correct, the new code will return "z70718".


      Extension to how AceDB handles GFF_feature in the Method class
      ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++

The ?Method class allows you to specify, via the GFF_feature tag, some
text that will be output as the "feature type name" in the GFF dump of
all features that specify that method.

The current model for specifying GFF_feature is:

?Method
     GFF_feature UNIQUE Text

Wormbase now uses the controlled vocabularly of the Sequence Ontology
(SO) project to specify these types. In wormbase these terms are stored
as the names of objects of a new class ?SO_term. Hence their model is now:

?Method
     GFF_feature UNIQUE ?SO_term

The GFF dumping code in AceDB has now been altered to cope with both
formats of data so you can leave your database unchanged or move, as
Wormbase has, towards a more controlled ontology.

------------------------------------------------------------------------


    Bugs Fixed
    **********


      AQL and the active keyset
      +++++++++++++++++++++++++

(/This article is courtesy of Jean Thierry-Meig/ mieg@ncbi.nlm.nih.gov
<mailto:mieg@ncbi.nlm.nih.gov>)

According to the AQL documentation, it is possible to initiate an AQL
query on the active keyset, known in aql as '@active' . This is very
handy, because the active keyset may result from a complex set of
operations that cannot be reproduced by the AQL command line, for
example it may result from reading an external file or be constructed by
a web cgi script.

Example:

acedb> keyset-read my_paper_list.ace
acedb> aql select p,a from p in @active:1, a in p->author

Unfortunately, there was for some time a bug in the definition of the
AQL @active table. This is fixed, and the @active construction works again.

------------------------------------------------------------------------


    Developers Corner
    *****************


      Acelib.h to AceC transition
      +++++++++++++++++++++++++++

(/This article is courtesy of Jean Thierry-Meig/ mieg@ncbi.nlm.nih.gov
<mailto:mieg@ncbi.nlm.nih.gov>)

In 1997, a tentative C interface to acedb, called acelib was proposed by
Greg Miller. This interface was implemented but, as far as we know,
never used***. Indeed, the interface was rather more complicated to
use on the server side than the direct ace kernel calls, and could not
be used on the client side.

Now that the new AceC C programmers interface is fully deployed, and
tested both on server and on client side, we intend to totally remove
the previous acelib code.

This means that the file acelib.h will disappear and anyone who was
using it in one of its application will have to include in its place
wac/ac.h and to rewrite his application accordingly.

If anyone is affected by this change, please email mieg@ncbi.nlm.nih.gov
for dicussion and support.

The removal will take effect before the end of october.

*_*_*/The only known usage of acelib is that the acedb kernel itself is
using it during bootstrap. The bit of acelib used in this way will be
kept, but will become private to the acedb kernel./


      Text Editor Bug
      +++++++++++++++

(/This fix is courtesy of Jean Thierry-Meig/ mieg@ncbi.nlm.nih.gov
<mailto:mieg@ncbi.nlm.nih.gov>)

There was a bug in the Text Editor code in AceDB which meant that it
would crash if you tried to create an editor of length < 16, fixed now.


      Displaying object class and name
      ++++++++++++++++++++++++++++++++

For sometime there has been a call in AceDB to return a string which is
a compound of an objects name and class (from wh/acedb.h):

char *nameWithClass(KEY k) ;				    /* returns
class:name   */

Some users found this confusing however as their databases adopted a
convention of including the ":" character in the objects name so the
result of this function when displayed would give something like:

*someclass:some:very:long:name*

There is now a new function in wh/acedb.h:

char *nameWithClassDecorate(KEY k) ;			    /* returns
class:"name" */

You can use this call to get a less ambiguous string that can be
displayed to the user:

*someclass:"some:very:long:name"*


      messubs changes
      +++++++++++++++

(/This fix is courtesy of Jean Thierry-Meig/ mieg@ncbi.nlm.nih.gov
<mailto:mieg@ncbi.nlm.nih.gov>)

Jean has fixed a couple of bugs and closed a loophole in the message
formatting code which is a fundamental part of AceDB. The original
loophole was caused by long standing inadequacies in the ANSI C
libraries for string formatting into fixed buffers.

Thanks to Jean for sorting this out.


      New function to return the name of an object from an OBJ pointer.
      +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++

A trivial addition but useful when running in a debugger, the new call
will return the name of an object given an object pointer, from wh/bs.h:

char *bsName(OBJ obj) ;					    /* return the name
of an object */

------------------------------------------------------------------------


    August monthly build now available.
    ***********************************

The August build will be available as AceDB 4.9.27 from Sept 10th onwards.

You can pick up the monthly builds from:

*Sanger users*
    ~acedb/RELEASE.DEVELOPMENT
*External users*
    http://www.acedb.org/Software/Downloads/monthly.shtml
    <http://www.acedb.org/Software/Downloads/monthly.shtml>

------------------------------------------------------------------------
------------------------------------------------------------------------
Ed Griffiths <edgrif@sanger.ac.uk> <mailto:edgrif@sanger.ac.uk>

Last modified: Thu Sep 9 09:40:13 BST 2004