🚀 go-pugleaf

robison1@husc9.harvard.edu (Keith Robison) writes:

>In article <eesnyder.697915657@beagle> eesnyder@boulder.Colorado.EDU (Eric E. Snyder) writes:
>>Just as _Drosophila_ P-elements appeared to have 
>>arisen _de novo_ in the 1920s...

>I know that P-elements are believed to be of evolutionarily recent origin,
>but THAT recent? (references please)

Yes, they are very recent.  I don't have the original papers handy
but a good start is Watson _et al._ _The Molecular Biology of the Gene_,
I think at the end of Ch 20.  If I remember the papers on the subject 
(ie. don't quote me), the presence of P-elements were assayed by squash
blot of _Drosophila_ strains isolated in various years from various 
geographical localities.  That hybridization was used as the assay
suggests that mobile P-elements were not just the activation of a 
previously dormant transposable element but rather entered _Drosophila
melanogaster_ from outside the species.  

The Watson text cites Kidwell, M. G. (1983) "Evolution of Hybrid Dysgenesis
Determinants in _Drosophila melanogaster_."  PNAS 80:1655-1659.

Anyway, I think seeing this sort of genomic evolution occuring on a 
human time scale is facinating.  Can anyone think of other examples?

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology              ...making feet for childrens' shoes.
University of Colorado, Boulder   
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------