Article View: sci.bio
Article #484Re: Creating life
From: Eric E. Snyder
Date: Fri, 03 Nov 1989 16:42
Date: Fri, 03 Nov 1989 16:42
24 lines
1697 bytes
1697 bytes
In article <19690@brunix.UUCP> jda@cslab9a.UUCP (Jeff Achter) writes: > >Additionally, we don't know how the transcription enzymes >know when to start and stop transcribing a stretch of DNA. There are >three possible reading frames on each of the two complementary >strands; which will be expressed? Until we know this, we can't >reliably craft a genome. Come now, we deserved a little more credit than that. I suggest the following reference: Pribnow, D. (1975) Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter. PNAS 72(3): 784-788. I hope the name rings a bell. --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder Department of Biochemistry Proctoscopy recapitulates University of Colorado, Boulder hagiography. Boulder, Colorado 80309 LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------
Technical Details
Message-ID:
<13488@boulder.Colorado.EDU>Path:
arc1-ca.pugleaf.net!utzoo!attcan!utgpu!jarvis.csri.toronto.edu!mailrus!ncar!boulder!eesnyderReferences:
<2461@umbc3.UMBC.EDU> <4516@utastro.UUCP> <2189@hudson.acc.virginia.edu> <19690@brunix.UUCP>Show Full Headers
Complete Article Headers
Path: arc1-ca.pugleaf.net!utzoo!attcan!utgpu!jarvis.csri.toronto.edu!mailrus!ncar!boulder!eesnyder From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder) Newsgroups: sci.bio Subject: Re: Creating life Keywords: Life Message-ID: <13488@boulder.Colorado.EDU> Date: 3 Nov 89 16:42:34 GMT References: <2461@umbc3.UMBC.EDU> <4516@utastro.UUCP> <2189@hudson.acc.virginia.edu> <19690@brunix.UUCP> Sender: news@boulder.Colorado.EDU Reply-To: eesnyder@beagle.Colorado.EDU (Eric E. Snyder) Distribution: usa Organization: University of Colorado, Boulder Lines: 24